>>36775989
do thing for mother

File: enders_game_concept_art_d(...).jpg (141 KB, 800x340)

141 KB JPG

>>36775989
>Current armory
269 Thorn Launchers
20 Thorn Cannons
123 Sting Casters
30 Cyclotrons
15 Rotary Stingers
3 Fire Sprays
5 Plasma Spray

>Current resource reserves
Nutrients: 596261
Metals: 351634
Credits: ₡2326
Credits in Lyle’s account: ₡577,450

>Hive population and upkeep cost
Hive maintenance – 534
Queen – 5
Fake Queen (2) – 44
Worker (4000) – 8000
Aquatic Worker (40) – 160
Vacuum Worker (200) – 1200
Radiator Worker (100) – 400
Warrior (209) – 1045
Aquatic Warrior (20) – 140
Thinker (500) – 1500
Quantum Thinker (150) – 750
Speaker – (3) – 12
Digger (80) – 320
Refinery (10) – 70
Sniffer (2) – 8
Small Sniffer (200) – 200
Fly (50) – 200
Wasp (100) – 500
Haz-mat Workers (20) – 80
Shock Troops (40) – 520
Parasite (30) – 120
Bio-tank (10) – 250
Excavator (200) – 3800
Colossus (20) – 300
Advanced Relay (68) – 6800 (set as default method of ship control)
Upkeep: 26958N

>Hive fleet
Space Pod (28) – 840
Shuttle (10) – 250
Mining Corvette (4) – 800
Scout Corvette (6) – 1350
Lancer Corvette (2) – 450
Fleet Corvette (4) – 900
Stealth Frigate (4) – 1952
Heavy Cruiser (4) – 4860
(Under construction)
Mining Corvette (2)
Vanguard Frigate (4)
11402N

Clone upkeep/special projects and expenses
25 Human captives of the USV Hope – 750
3 Human hybrid clones in production – 180
Lyle Rogers – 47
977N

Total upkeep
Nutrient costs: 39297

>Income
Metals: 56500
Nutrients: 100050
Net: 60753

>>36775989
Have our speaker drone act like he heard what Seiner said and start freaking the fuck out.

>>36775989
>Hive Queen Quest 31.2
You mean 32.2?

>>36775989
lets build some 'Royal Guard'

File: 109243.jpg (792 KB, 1860x1341)

792 KB JPG

>>36776004
Hive Structure
G-426
>Asteroid mining base: 5 Excavators, 20 Diggers, +2250M per day (+50 M per digger, +250 per excavator)
Leeland
>Spring mountain hive
>Hangar facilities: Room for 40 Aero/fighter Drones and 20 Shuttles (25N)
>Docking Pylon (3): Space for docking and construction of 4 ships (150N)
>Mine: 195 Excavators, 60 Diggers, +50250 M per day (+25 M per digger, +250 per excavator)
>Clarke Research Outpost
>Hel’s Angel Prison Outpost
>Mountain farm complex
>Algae Farm: +100000 N per day, 1000 Workers (1 worker per 100N)
>Anti-orbital battery: 2 (125N per battery)
M-662
Raligha
>Automated Raligha colony [no trade active]
M-323
>Orbital docking pylon (50N)
>Mining corvette salvage operations +4000M per day (+1000M per corvette)

Current Construction
1 Docking pylons
4 Heavy cruisers

File: Am_wayne_barlowe_04-1-.jpg (38 KB, 600x321)

38 KB JPG

>>36776012
New Construction Options
>Algae Farm – +100N per day, 1 worker to maintain
>Hangar Expansion – Add on to current hangar facilities for your choice of +40 aero/fighter drone space, or +20 shuttle space. 50N 100M
>Anti-orbital battery – A bunker armed with a massive Particle beam capable of attacking ships in orbit from the ground. It includes the power and sensor systems required to operate it. 250N 1500M
>Docking Pylon – A large spire or station that contains space for docking and construction of 4 ships, or a single capital ship if placed in orbit. 100N 300M
>Surface to Orbit Missile System – This massive bunker complex houses a wide range of warheads and a nigh limitless number of missiles within its protective walls, allowing you to launch missiles against approaching invaders from the safety of your hive. The facility uses the ship missile stats and comes equipped with a single Cruise missile silo that can target any detected object within the system, five Stinger missile silos capable of targeting any craft within high orbit, and ten Swarm missile silos specialized in targeting high altitude aircraft and low orbiting targets. The facility itself is a massive complex spread out over several miles, and includes guidance and launch equipment, as well as the means to construct and maintain a stock of warheads and missiles. (1500N 2500M)

Ship Construction Options
http://pastebin.com/YTwGk8n1

>>36776008
Well crap. Why do I always mess something up in the second thread's op?

Use a flyer to kill that bastard Seiner after we explode the speaker drone on the operating table. Other drones break out an go on killing spree before blowing up.

>>36776007
What, make it seem like the Speaker just has crazy limited omniscience or something?

'Good listeners' indeed.

File: springtime_by_ahaas-d7dqjaj.jpg (160 KB, 900x602)

160 KB JPG

>>36776023
Finished research

>Ultrasonic Sledgehammer
Designed to be used to breach doorways and walls, this fist-mounted device uses a burst of ultrasound to annihilate a physical object. While it is intended for use in demolition, it is frighteningly effective against live foes as well. The sledgehammer takes the form of a large chittinous piston on the arms of a drone, which pull back to ready for an attack, and then fire forward, causing a short ranged shockwave to erupt from the large ‘fist’. This replaces a drone’s blades. (6N 10M)

>Drop pod
Drop pod launcher - A compact launch bay that manufactures and launches cheap, disposable heat shields capable of dropping a drone safely from orbit. Each drop bay contains 50 medium sized launch tubes, and 25 large, but is capable of making and storing enough pods to launch any number up to the maximum the ship hull can hold. Every medium pod costs 10M to deploy, while large cost 20M (50N 100M)

>White Crystal
This device shows a number of uses. The most obvious is that it appears to serve as a kind of data storage similar in nature to the Skyl datacube, but through the use of tachyons, as well it appears to function as a kind of control system for some joint hive-skyl devices, and offers a translation between hive thought and skyl language. It also appears to have a slight side effect in that it appears to bolster the mental connection when held and connected to, although this feature will require more research, as it appears to be an unintentional effect.

>>36776030
I meant more like, Literally heard, but that works too. Might even up the spooky a bit.

File: riverscene_ii_by_ahaas-d7dqji1.jpg (157 KB, 900x679)

157 KB JPG

>>36776035
New research unlocked

>Psionic fortification
Slow
Further research of the white crystal’s beneficial effects on your own psionic link to your drones could lead to some manner of defense against a psionic jammer.

>Psionic Cannon prototype
Very slow/Very dangerous
Detailed accounts of several experiments show the slow progress of Project Godsplitter. The cannon itself is highly volatile, and even the smallest miscalculation often results in the destruction of the ship, as well as any nearby craft. It can only be equipped to a Hive ship's spinal mount, and requires a functional Void Shard as ammunition. At least a dozen testing sizes were atomized in testing the weapon, and in the end it appears The Gardener never quite perfected it.

>Weather Spire
Medium
A specialty of The Gardener which was apparently shared with the Skyl to solidify their alliance. It is a massive spire capable of analyzing and altering the atmospheric composition of a planet over time, as well as altering localized conditions to alter weather patterns.

Oh man, I really need to get to sleep. I'll be sure to catch up on the thread tomorrow though. Don't do anything too stupid.

>>36776046
>Psionic fortification
ALL THE RESEARCH.
INTO THIS.
RIGHT NOW.
I mean screw the other shit, this is incredibly important.

>>36776046
Start new research.

>Psionic fortification
>Weather Spire

These are the best options right now.

>>36776046
Can we mount another expedition to Reprieve to gain more info on Mother's finished version of the Psionic Cannon? That would at least speed up the research here. Though I admit that we run the risk of alerting Obsidian to our existence.

>>36776027
Nah, I think we should blow them up more politely. Property damage is fair game, but let's leave the personnel alone. I have a soft spot for scientists.

>>36776037
Seiner said it in a different room nowhere near our Speaker, so it'd have to be creepy space magic.

>>36776053
Quantum Communications is the more obvious stopgap solution. Still didn't start that. Forgot about that. We have that new sample to reverse engineer bought off Space Amazon.

>>36776068
Let's go with creepy space magic, then. Have the speaker drone freak the fuck out.. Keep the "Young ones" standing completely still. Maybe have them start slowly scratching out creepy things onto the walls and floors while remaining mostly still.

>>36776046
>Psionic fortification
I think it's safe to say that this'll get enough support for immediate research that a dedicated vote is not required.

>>36776068
>Property damage is fair game, but let's leave the personnel alone. I have a soft spot for scientists who work for a hostile military and want to cut us open so their friends can kill us better in the future

Anon...

>>36776092
Yeah, they're just like our Thinkers, if you think about it. We wouldn't want anyone hurting our adorable little Thinker buddies, now would we?

>>36776046
The door to the speaker's small cell opens and a number of armed and armored guards stand just outside. There is a small crate in the center of their formation, and two of the guards are holding what appears to be a claw mounted on the end of a long pole.

>Charge the guards with your speaker
>Detonate your speaker
>Detonate all your drones
>Detonate 1 worker and try to burn through the wall
>Feign naivete and cooperate
>Other

>>36776092
Not that anon, but personally I wanted to capture Steiner and introduce him to a parasite buddy, but given the current situation, killing him will have ton suffice.

>>36776105
>Detonate 1 worker and try to burn through the wall

>>36776105
>>Feign naivete and cooperate
Get as close as possible to the good doctor, once they try to put the Speaker under, blow it.

>>36776105
>>Feign naivete and cooperate
"Humans really do like Boxes huh?"

>>36776105
>>Charge the guards with your speaker
And if it gets stabbed and acidsplodes, so much the better.

>>36776105
>Detonate 1 worker and try to burn though the wall

>>36776105
>>Feign naivete and cooperate

>>36776105
>Feign naivete and cooperate
"Is Lee here? Are you taking me to Lee now?"

>>36776105
>Burn through the wall

>>36776105
>>Other
Okay, Better idea then freaking the fuck out. Co-operation, but don't feign naivete. Keep asking if the speaker is to be recycled, or repeatably ask what it did wrong.

>>36776105
>Detonate 1 worker and try to burn through the wall
>Feign naivete and cooperate
Both. I want to spread the workers out and cause as much facility damage as possible.

I don't want to kill Seiner, I want to ruin him.

>>36776105
>Burn that wall.

>>36776116
>>36776118
>>36776105
This. Keep up the charade for a little longer.
And have the workers stand facing the walls, slowly skritching out messages that will be done by the time we detonate our speaker in the dissection room.
Messages such as "The humans lied", "Who is researching whom", insect eyes, "They're watching, humans", and other assorted creepy messages.

maybe we can help unity hack into this place.

>>36776152
Okay, I like this idea quite a bit. Supporting this.

>>36776148
This made me chuckle. "This one will comply with the human hive recycling it." or something.

>>36776153
So long as he shares the research with us, fine.

>>36776105
>>Feign naivete and cooperate
Contact Theseus (we have located Seiner)

>>36776152
That's retarded. Totally incorrect form of creepy. I'm disappointed.

>>36776152
First things first. Do we even know how to write the human language?

>>36776162
>>36776153
I'm game plus they should be freaking out during this commotion, maybe they would say passwords or type something up.
We should contact thesus real quick.

>>36776162
>>36776153
Problem is, how? We didn't carry one of them USB biodevices, all we know is the location of the facility. Unless Theseus/Unity sends ships in a timely manner, but then again it'll alert the humans who might think we're allied with Unity.

>>36776174
Human memories.

>>36776161
"Please leave this one with the juveniles, they will recycle this one."

>>36776105
>Detonate 1 worker

>>36776172
How about having all the workers stare at the humans. Just standing still and staring. When they turn around get them to make noises with their mandibles.

>>36776148
This is good. Also let the humans know that hostility is unwelcome, unbecoming, and unacceptable.

The drones are not stuck in the lab with the humans. The humans are stuck there with the drones!

>>36776182
We can spy something or even help thesus out by cutting something.

>>36776193
"This one does not want to be recycled. Why are you doing this? Please stop. This one does not wish to be recycled. This one did a good job. This one is a good speaker. What did this one do wrong? Please stop. Please let go of me. What did this one do wrong? Please stop. Please stop. Please stop."

>>36776105
>Detonate 1 worker and try to burn through the wall
No fancy shit; we go in there and we try to wreck as much of their stuff as we can.
Ideal targets are something big and important and explodey.

>>36776182
we could always try to pick up their comms or cut some wires, hell we have spy drones lets get them to overhear shit.

>>36776162
I wonder what he will find out.

Can we please turn up the creepy? We're going to end up blowing them all up anyway, At least let's have some fun with it.

>>36776201
Like that one part of Mass Effect 2? The one with the Living computer that couldn't handle all the data. "It hurts, please make it stop. It hurts, please make it stop. It hurts, please make it stop.

>>36776225
Yeah, Sorta! Less "Kill me" and more "Don't kill me" though.

Also, guys, if we just fuck up everyone's shit seemingly unprovoked, wouldn't we give fuel to the people wanting to go to war with us?

>>36776153
Will he be willing to help?

>>36776240
Anon, this isn't unprovoked. This is self defense.

>>36776240
Nah, this is a secret military lab, no one know what happens but the people here and the high-ups in government, besides, they unlawfully detained us first, and they're going to dissect our poor speaker, we can call this as self-defense.

So what are your guys thought on harvesting the juices in the film? I'd like to at least try it to see how many nutrients it would yield. Wouldn't cost much to learn either just one drone which could be recycled if we don't want to utilize the film.

File: 1401436140290.jpg (60 KB, 498x326)

60 KB JPG

>>36776240
>Keeping us in cages
>Running tests on us
>Dissecting us because Siener got butt flustered

Totally unprovoked...

>>36776246
>>36776260
Can we at least wait until the speaker has thoroughly tried to guilt-trip seiner and blew up before the workers freak out?

>>36776245
Its free tech, but he might be more interested in the othger AI.

>>36776105
"Is the speaker to be recycled? Did it perform its task poorly?"

"Get in the box." One of the guards says. Their weapons are raised and the claws outstretched. Your speaker moves forward and the humans jump back slightly. Your speaker chitters at them.

"This speaker did a good job, the Seiner is poor at listening." A claw reaches out to the speaker and its blades unsheathe partially. The humans leap forward with the poles and quickly jab at your speaker, the claws clamping around the speaker's neck. It lets out a chittering screech as its blades lash out, nearly reaching the far ends of the poles, and the human guards pull the speaker forward.

>Have your speaker cooperate as your workers attempt to break free
>Have your speaker attempt to fight
>Other

>>36776265
I wasn't saying it was ACTUALLY unprovoked. It could LOOK unprovoked easily, if they tried.

I wonder what a 'knight' drone would be like. A queen needs knights to serve her.

other idea: can we capture alpha predators on our planet, put parasites in them, and release them to operate as some inconspicuous secondary defense.

>>36776278
Can we contact thesus real quick?

>>36776246
seems more anons how can't have patients and build a false since of security in the humans to me..

>>36776278
>>Have your speaker cooperate as your workers attempt to break free
Have the speaker continue asking what it did wrong, but also warn them repeatably that this is a bad idea, and the juveniles weren't meant to be left alone

>>36776278
>>Have your speaker cooperate as your workers attempt to break free
and this >>36776289

>>36776286
Shock Troops is the closes we have, you could replace it armour with heavy and give it sledgehammer arms.

>>36776278
>Have your speaker fight.
>Contact Theseus.

>>36776287
we could. I've suggested it before, but no ones thinks it's important apparently.

>>36776278
>Have your speaker cooperate as your workers attempt to break free
>Other
Warn the humans, and also Contact Theseus.

>>36776278
>Have your speaker cooperate as your workers attempt to break free
I want the self-destruct (it is the harmful kind, right?) to either harm Seiner, the commander, or ruin there equipment.

>>36776310
Vote fpr it than.

>>36776319
Already did.

>>36776319
I vote aye, because it's definitely popcorn time with our best AI buddy. What better bonding time than trolling some black ops labs?

>>36776296
Heavy armor + conductive carapace, sledge arms, grenade launcher+ cryo spray for weapons, oxygen recycler is basically my design for a heavy close range drone meant for boarding actions, tunnel defense, and breaching actions.

>>36776331
No advance senses or smarter brains for the Queens protection?
You could add hover legs as well.

>>36776278
>Contact Theseus

>>36776278
the two guards begin to slide across the floor as your speaker chitters at them. An electronic hum comes from their boots and their feet stick in place, and the whirl of straining servos comes from their armored joints. As smoke begins to trail from their knees and elbows your speaker finally begins to loose its grip and slides towards the crate.
"Humans act poorly. Workers need close attention! The speaker fulfilled its duty, it is not defective."

Your speaker's claws tear out several gashes in the small crate as a set of armatures grab at its carapace. As they seal the door to the box several guards fall against the walls.

"Holy shit, that thing just stripped the move-assists.Things as string as a damn auto-loader."
The two guards struggle to remove the mechanical joints from their armor, which each fall to the ground in a small cloud of smoke with the smell of ground metal.

>Contact Theseus (write in)
>Don't
>Other

>>36776384
>Contact Theseus (write in)
Mention the lab, and ask him if we can help in hacking in any way,

>>36776384
>Contact Theseus (write in)
Let's at least tell him we found Seiner.

>>36776343
We've got dedicated sensing drones. Hover legs is a possibility, but kinda expensive and mitigate absurd defence somewhat. Either or.

>>36776384
>Contact Theseus

We will send you the location of Siener. If you share all research obtained on site.

>>36776393
2nding

>>36776384
Holy shit our children are strong
>Contact Theseus (write in)
How'd you like to know where Steiner is right now?

>>36776384
Jesus if a mere speaker is that scary, than how scary are our shock trooper/warriors, and large drones.

>>36776407
Our children aren't strong, Humans are just weak.

They're such a pitiful little species.

We're getting more and more equipped to have citizens in our Hive of other species.

>parasites give pseudo-access to Hive Mind, making living with us easier.
>Healing tanks and adjustable nutrients.
>Cool cybernetics as perks if they want.
>Possible longer lifespan

And the perks would just improve. Elizabeth's getting a good deal already.

>>36776384
>Contact Theseus (write in)
"The Hive has located Seiner at [location, I can't remember]. Capture is impossible, but assassination may be possible. What is your consensus?"

>>36776419
We don't have "Citizenship", We have "Adoption"

All who holds our gifts, are our children.

>>36776419
don't forget near perfect cloning up to their death,

>>36776419
Also, with the parasites, we can find and root out any spies and traitors.
>>36776427
>Adoption
Yes, all will love Mother

>>36776437
The parasites are a shitty deal and most people are going to feel that way.

>>36776446
Well tough luck for them, you wanna stay with the Hive, you gotta live by the Hive's laws.

>>36776460
"I don't want that thing inside me, invading my privacy!"
"I suppose you don't want immortality, either? I always thought that was a big deal for you humans."

>>36776437
The self-destruct isn't a kill switch though (at least it's not supposed to be. It's the "safe" kind but it was never activated *inside* an organism).
It should only be needed if the host is dead or if it's being removed. Plus it has several benefits. It's more of a Symbiote really

>>36776470
Not yet but getting there. I hope we get it for Elizabeth, make her an official member of the Hive and stuff.

>>36776437
With our love, We will bring peace and unity for all races.

No longer will the children squabble with eachother, They will have a purpose. To serve Mother.

>>36776494
Wo do with clones essentailly.

>>36776507
There's the gene therapy research going on. It's specifically for humans, and is meant to drastically extend their lifespan, perhaps to practical immortality.

>>36776512
either one is eternal life.

How would everyone feel about making a bit of a training arena, Specifically for Elizabeth and/or Lyle? We can maybe give Elizabeth an egg layer and help her practice her gift, and Lyle can practice working together with drones to increase his combat effectiveness.

>>36776470
Eh, mostly for control freaks.

Anyway, it's not a problem as long as it's adoption and not abduction. But then, it's not necessary either.

>>36776532
cool

So consensus is to try and hack, but also inform Thesues of the guys location.

>>36776558
>Consensus is make drones freak out and get Theseus to help hack this place.

>>36776384
You assemble a small data packet containing the location of Seiner, and the general estimated location on the planet of the laboratory. Your pod watches as Zero One becomes silent.

"You know his location with certainty?"

"Yes. He is with several drones now."

There is a long pause as Zero One churns over the information.
"And he is aware of your drones' presence?"

"Yes."

There is another long pause.
"The I cannot act without implicating our cooperation. This would be less then optimal for both of us. Please do what you can to prevent his escape. I am unable to enter the space noticed, and there is no vulnerable network in the immediate area available to me, but I thank you for the information."

"What do you wish for the drones to do?" You ask. His reply is immediate.

"Kill him."

Your speaker thrashes in the restraints within the cage as it is quickly rolled down a hallway and into a large, mostly empty room. A single table is located in the center surrounded by a number of large lights. Seiner can be seen on the other side of an observation window, and several surgeons enter through another door.

"How do we even sedate it? Do we know if anything works?"

"We don't know anything for sure, but they seem to be able to metabolize similar stuff as most life, so we can try the usual suspects." A man in a bright yellow and orange bio-hazard suit is assembling a large syringe on the end of a pole, and he hoists it into the air. Your workers begin to thrash in their room, to the shock of the observing researchers. One of them reaches for the gas button in a panic.

>Detonate your speaker and attempt to have your workers escape
>Continue to wait
>Speak with Theseus (write in)
>Other (write in)

>>36776602
>>Detonate your speaker and attempt to have your workers escape
Have them scramble to Steiner's location

>>36776602
>Speak with Theseus (write in)
Ask him, if us giving him a ride works?

>>36776602
>>Detonate your speaker and attempt to have your workers escape
Yell more. Yell that the workers shouldn't be left alone. Keep up with the yelling we've been doing so far.

The moment the speaker drone explodes have the entire back of workers freak out and break out.

File: 951.jpg (42 KB, 580x346)

42 KB JPG

>>36776602
>Detonate your speaker and have your workers escape.

IT'S HAPPENING

>>36776602
>Detonate your speaker and attempt to have your workers escape
Detonate one of the workers for a more immediate escape.

Would a fly drone be able to kill him?
Did we equip any of our flies with poison?

>>36776650
I want to see if we can violently tear him apart with worker drones.

>>36776602
>Other (write in)
"Seiner human! What do you desire? How can speaker prove itself? Will you be there for my recycling?"

Try to lure Seiner close. Get him to taunt us or something. Then blow up in his face.

>>36776602
Act sedated until operating room

>>36776602
>Detonate your speaker and attempt to have your workers escape
"Prepare for unforeseen consequences, Seiner."

Denote one of the workers to dissolve through the glass window and start attempting escape/sabotage.

>>36776602
>Detonate a worker; the proletariat must rise up, and escape their bondage.
>Speaker will defend itself, and buy time.
>We need to maneuver our workers to get to Seiner.

>>36776602
Get the speaker in the box, stay smart. Lure Seiner.

>>36776602
WAIT UNTIL WE ARE ON THE TABLE AND SEINER IS STARING US IN THE FACE

>>36776602
>Detonate your speaker and attempt to have your workers escape

Maybe when we make "official" contact with the humans as a space-faring species to be respected we'll mention this incident. Then act cheeky and say messing with them and trolling them was quite entertaining and in good fun. No hard feelings.
An extra act of cheekiness by gettin them a whole lot of heat from the people and the government in almost starting an interstellar war with their dickery and insulting them by showing they got punked the whole time and treating it like a game.

The humans will make 'Cheeky Insect" memes after that day.

>>36776727
We can't risk them successfully sedating the drone and taking samples or perhaps even successfully performing a full autopsy.

>>36776770
A more cheeky response would be that we were conducting research on human behaviour. How do they react to an ostensibly mentally limited being in captivity? Apparently their answer is to dissect it.

Maybe we have more in common than we thought.

>>36776771
>>36776727
This. And of course Seiner will not dare risk being close to us, what with the power of our speaker being evident.
What I suggest is to have the workers use one to blow out an escape route, and wreak havoc so that we can kill Seiner.
Alternative plan is to send a cloaked cruiser to finish the job when our drones fail.

>>36776808
We could leave behind one drone as a bait for Seiner. Have it continue to be in the cooled down state and non-reactive then explode it when he tries to examine it.

>>36776808>>36776808
>This. And of course Seiner will not dare risk being close to us, what with the power of our speaker being evident.
>What I suggest is to have the workers use one to blow out an escape route, and wreak havoc so that we can kill Seiner.
>Alternative plan is to send a cloaked cruiser to finish the job when our drones fail.
.Fuck all of that especially the last bit.

For fun, I say our main plan of attack is have our workers tear shit up and destroy data and maybe try to reach Seiner to rip him apart. Violently.

Have the fliers be constantly on his tail as back-up, to slow him down or fuck him up.

>Detonate a speaker to break through the window and send the Drones in to kill Seiner

>Before detonating, have the Speaker say: "You forgot one thing Seiner: The Queen is always in control."

>>36776831
>Have the fliers be constantly on his tail as back-up, to slow him down or fuck him up.
Nah the flies should stay hidden since we can use them to spy on humans and steal their research.

>>36776838
Nope. Don't mention the queen as other people can still hear it and report that our speaker said that.

File: ss27.jpg (41 KB, 1280x720)

41 KB JPG

>>36776602
Your speaker struggles at the restraints, and one of them pops loose.

"Get the sedative, quickly!"

A lab tech hoists the sedative and jabs it into the crate, and your speaker starts to grow still. Your thinkers immediately work on an immunity to the used sedative, but your speaker is quickly loosing consciousness. As it drifts away it manages to stammer out a single phrase.
"The humans have made a mistake."

It explodes, bursting open and sending acid filled innards across the room. The lab tech's arm begins to bend, and then falls to the ground like a lump of clay as his plastic face mask crumples on itself with a sizzling and a thin pillar of wispy smoke. He screams, and quickly collapses. Several guards struggle to strip off their burning armored plates, and several others slump to the ground with the consistency of melting slush. Immediately a chemical alarm blares into the room and yellow lights flash along the walls. Seiner watches in horror. It takes several seconds for him to notice the intercom alert beside him. He finally hits the switch.

"W-what is it?"

"It's the workers. We have a code black, jesus!"

A loud sizzling can be heard from your listening fly, followed by the chittering of mandibles. The alert spreads to the rest of the facility as a computer voice drones out over the intercom.
"Multiple specimen containment breach. Security to containment facility."

Seiner turns off the intercom, muting the sound of crunching and chirping. He looks to a staff member to his right. "Lock down this facility. Now!"

Your workers crawl their way through the melted hole in the transparasteel and over the bodies of several researchers. Their remains drip from the ceiling and slide down the walls as your workers force the door open and rip open the grates to the air vents.

[Hive forces]
>4 flies
>9 workers

>Charge your workers into the hall and attack
>Move into the air vents
>Other (write in)

>>36776880
>Move into the air vents
Time to go full xenomorph on their asses.

>>36776880
>Other (write in)
Have our flies locate Seiner and co-ordinate with our thinkers to map out a route to him. Have 3 workers charge into the hall as a distraction while the others go into the vents.

>>36776880
>move into the air vents

If the speaker could fuck them up that much, the workers will be hell if we use hit-and-run tactics.

>>36776880
>>Move into the air vents
It's time to fucking aliens this bullshit.

Cut all exits. They might do that for us anyway.

Search for power generation. Shut down everything once we ensure that the exits are locked tight. Go silent. Start picking people off.

Start writing creepy shit on the walls with blood and scratch marks.

>>36776880
>Move into the air vents
Have at least one fly following Steiner, the objective is to kill him and damage any other targets of oppurtunity

>>36776880
>Move into the air vents
>2 flies get into the wiring of the base to sabotage.
>1 fly uses commotion as cover to look at their other research
>1 fly keeps tabs of Seiner.

We horror movie now, bitches!
Very bad for the asshole characters, Seiner!

>>36776914
Seconding.

>>36776880
>Move into the air vents
Track the doctors with the flies.

>>36776914
Not the best use of our flies.

>>36776880
>Move into the air vents
>>36776914
Seconding.

>>36776955
What would you suggest?

>>36776955
maybe not.
Better suggestions?

>>36776995
2 Flies to find and track Seiner
2 Flies to search for potential targets or things of interest.

>>36776986
>>36776995
>2 flies get into the wiring of the base to sabotage.
>1 fly uses commotion as cover to look at their other research
These two work against each other since most of their research is on their computers and cutting power would shut the computers down, not to mention they're on lockdown. We should just focus on tracking Seiner.

I wonder if we can give Theseus a pseudo live stream of what's going on through our mind. I'd love to get their reactions when we go all aliens on them.

>>36776880
>Move into the air vents

It's time to play a little game I like to call 'Nostromo'.

>>36777040
This.
He might actually be able to help us out.

>>36777021
I meant infrastructure, like lights, doors, cameras, and alarms.

>>36777053
We should probably take control of the doors and stuff. Let's seriously just trap them all in here with us.

>>36777040
This is a good idea.

>>36776880
Your workers crawl into the air vents as you hear the sound of boots hitting the floor. A squad of armed guards rush to the tattered and bent metal door. Your drone listens as they move in, their footsteps clanging against the floor paneling.

"What in the hell happened here?"

"The vents are torn out. They could be in the air ducts."

One of your flies watches Seiner from an air vent as he enters various security codes into a computer. Your other flies are still spread out in the facility, where they had been observing the researchers near your workers and speaker.

>Have your flies chew through power cables
>Map out the rest of the facility
>Other

>>36777074
>>Have your flies chew through power cables
>>Map out the rest of the facility
Can we tell theseus the codes?

>>36777074
>Map out the rest of the facility

>>36777074
>>Have your flies chew through power cables
Anything that can slow Steiner down.

>>36777074
>>Have your flies chew through power cables
>>Map out the rest of the facility
Both of these are good. Bring the workers deeper into the vents to hide them.

Also, find any exit from the building big enough for a human. Seal it.

>>36777074
>Map out the rest of the facility

>>36777074
>Have your flies chew through power cables
Even if it kills one or two, we need to slow him down.

>>36777074
>Do both.

>>36777074
You split your flies up, sending two to map out the air vents of the facility, and the other to chew through the various power cables running through the ceiling.

Please roll 1d100, best of 3.

>>36777074
>Have your flies chew through power cables

Rolled 98 (1d100)

>>36777106
Let's hope this works out okay, eh?

Rolled 7 (1d100)

>>36777106

Rolled 83 (1d100)

>>36777106

>>36777114
Holy hopping hey-soos.

Everything gonna be ahhhhright.

Rolled 12 (1d100)

>>36777106
>>36777114
GLORY FOR THE HIVE

File: Dice Gods are in my favor.jpg (14 KB, 250x200)

14 KB JPG

>>36777114
God damn I love our flies. They are so amazing.

>>36777114
These poor bastards never stood a chance....

File: 313.gif (167 KB, 500x500)

167 KB GIF

>>36777114
>>36777124

FLIES NEVER FAIL!

File: Praise the Sun.jpg (289 KB, 714x700)

289 KB JPG

>>36777114

>>36777114
You know, I was going to go to sleep
But instead I stayed up until 7am to roll this die
For our glorious mother.

>>36777114
Seiner dun goofed.

Make the wayward soft ones pay for their foolishness.

>>36777114
Can the queen transmit the codes the flie saw?

I'll laugh if 9 workers and 4 flies take over this facility.

All of our workers and flies have quantum brains right for this mission?

>>36777258
Of course, otherwise they'd be in a come when they were under FTL transit

>>36777258
They are ready and willing to throw themselves into an incinerator if it comes to that.

>>36777249
I'm already shaking with maniacal laughter.

>>36777263
Just asking since you only need one drone with the brain, and the flies were made without them(i think they should have them since it makes rolls eaier and keeps them alive when not in contact).

File: 1_1401190453.jpg (369 KB, 4000x2259)

369 KB JPG

>>36777106
Your drones quickly move from deck to deck to scout the facility. It is built in several layers, with the medical wing on the lowest level, and the containment facility above that. A number of small apartments are spread out along the level above that, with several smaller medical facilities intended for actual medical procedures as opposed to research spread among the living quarters. Near the center of the deck is a large botanical garden filled with all manner of Earth-like life, and a number of barracks and weapon lockers are scattered through the facility, which guards scramble over as they equip themselves. At the very top is the hangar bay, with a single elevator running diagonally from the hangar to the far side of the containment level. Several freight elevators run between the lower medical wing and the containment area.

Seiner is in the lower medical wing, while your workers are in the service shafts and air ducts of the containment facility above.

“We need to contain this. Have the guards lock down every access port from here to the arboretum, they can’t get to the surface.” Seiner swipes a key card on an elevator terminal as he speaks, and it responds with a grinding screech, then the lights flicker and die. A moment later a pitiful flashing yellow emergency light comes on, spinning on the wall as sparks cast harsh shadows along the corridor. “Dammit, they cut the power. We’ll need to use the emergency access.”

Several guards look over their equipment, mostly tranquilizers and stun batons.
“What do you mean they cut the power? How’d they cut the power?” A guard asks in a growing panic. The sound of distant alarms stutter as power outages roll over other sections of the base.

>Have your workers move to the lower level
>Ambush the responding guards in the containment level
>Other

>>36777422
>>Have your workers move to the lower level
First things first
Though having a couple of workers going Aliens on the guards is fun

>>36777422
>Destroy the emergency access

>>36777422
Man i'm being indecisive as shit.

>>36777422
>Have your workers move to the lower level

>>36777422
Tell theseus the facilities power is down so he could sneak in.

>>36777450
Supporting this.
Sabotage any escape routes they have.
We're not trapped in here with them. They're trapped in here with us.

Could our flies kill him?

>>36777450
supporting

>>36777465
No he fucking can't. There is an orbital presence here, he can't just 'sneak in' onto a planet's surface.

>>36777476
If we run out of options, we can have one of our flies flit into his throat and block his airways. Anything can be a weapon if you try hard enough anon.

>>36777422
>Have your workers move to the lower level
Seiner is the target, all other priorities rescinded.

>>36777493
Or we could have them fly onto him and explode.

Regardless, I want to torture him first.

>>36777513
I don't remember us equipping the suicide sacs into the flies. They should just be regular flies thus no suicide command.

>>36777513
Why? That's impractical.

>>36777523
Fly
Olfactory: Advanced 2
Acoustic: Advanced 2
Radio: Advanced 6N 3M
Electrical: Advanced 3N 2M
Psionic: Basic 0
Arms: None
Legs: Sprint 1
Wings: Advanced 4
Carapace: Adaptive Camouflage 8
Mimetic skin 2
Radiator tubes 4
Oxygen recycler 8
Acid glands 1
Size: Small X .25
Cost: 9N 1M
A literal fly on the wall, this drone can infiltrate and observe in virtually any situation. It is almost impossible to detect or catch, and is more than capable of observing the enemy from under their noses unseen.
>>36777513
impractical, its better to go in his throat and self distruct.

>>36777523
No, all flies have acid glands. They can't explode violently, however.

>>36777523
>They should just be regular flies thus no suicide command.
Regular flies have acid glands.

>>36777524
How often are we honestly going to be able to go full xenomorph on someone?

Seriously, this is already a fucking horror movie. This is gold. They don't even have proper fucking weapons, We'll tear them apart with our workers.

And we can track his every movement with our fliers. We know exactly where he is and what he's doing. We can easily end this whenever we feel like things are getting too much.

>>36777546
But they're regular 'safe' acid gland.

>>36777543
>impractical, its better to go in his throat and self distruct.
I hope that's sarcasm.

>>36777562
But they should still be able to fuck up soft tissue, like the inside of a person's throat.

>>36777569
Oh shut up. It's a stupid idea and you know it.

>>36777558
This being said, we can always just kill Seiner first and leave the rest of his little party to play through our own personal horror movie.

The asshole scientist always dies first.

>>36777558
Famous last words. And we can go alien on people pretty much whenever we want.

>>36777581
This. Let's kill him first, then play with the goons- who knows, we could scratch ominous messages after we're done, like "I'm sorry Ma" near a corpse, or "Under surveillance", "You're next", "Big mistake", etc.

>>36777632
We should definitely start scratching increasingly weird things into the walls.

>>36777632
Why are you so obsessed with handing the Union more intel on us than is necessary?

>>36777646
Right, we shouldn't scratch them in, but make it so the messages look like they're written by our victims, then?
Make them get really really confused and hopefully think they're handling with supernatural matter. Or alternatively, the explanation is 'for the lulz'.

>>36777646
The call to be dramatic and hammy is hard to resist.

>>36777632
>>36777643
>>36777688
Maybe we could write repeats of stuff that we've heard. Like the cat comment. "Not a cat"
Or, Maybe, just going with something a little simpler.

"CATCATCATCATCATCATCATCAT"
"GET RID OF IT"

File: 41666461.jpg (34 KB, 360x288)

34 KB JPG

>>36777422
Your flies quickly identify a number of cramped passageways leading between the containment and medical levels. Your drones quickly make their way to the lower levels as Seiner and his team move to the emergency access tunnel, a small maintenance shaft hardly a meter wide. Darkened corridors crisscross with the shaft, leading to other areas and tracing various power conduits. Seiner pulls a small lever on the wall and the access opens with a grating metal iris that slides open with a creak.

"Okay, who's first."

There is a long silence. A distant chitter echoes its way through the shaft.

"You can't pay me enough." One of the guards says.

"Well what do we have for weapons?"

A guard looks through several bags. "Three stunsticks, a pair of torches, and a slug pistol."

"What the hell kind of security locker did you go through?"

"The kind intended to protect against viral outbreaks and the occasional infected, not fucking aliens."

Seiner looks through his tablet, scanning a schematic of the facility for other routs. "Well their's a substation not far from here with an express elevator. It won't be working but if we can get the doors open we can climb the shaft straight to the upper level."

"Great" someone says. "How do we get the door open?"

Seiner points to the shaft. "It's a much shorter ways. A small power conduit needs to be rerouted, it should be about fifty meters from here."

A scruffy faced man in a brown security suit grabs a torch. "Fine, fuck it, I'll go, but you better fucking be here when I get back."

The man climbs into the vent and starts to move, the small light of the torch held in front of him like a security blanket. The not-so-distant thumps and scrapes of your workers echoes through the shaft.

>Attack the guard and sabotage the power conduit
>Attack the guard, but allow him to reroute power first
>Other (write in)

>>36777719
>>Attack the guard and sabotage the power conduit
Would they be easier prey while climbing the elevator shaft?

>>36777719
>Attack the guard and sabotage the power conduit

Shit's fucked.

>>36777719
>>Attack the guard and sabotage the power conduit
Going straight to the upper level? Oh no, I don't think so.

Don't kill him. Give him a real good scare and some injuries, enough to limp by. We have to kill SEINER first.

>>36777719
>Attack the guard and sabotage the power conduit

>>36777719
>Other (write in)
Sabotage the safeties on the elevator and drop it on them as they climb. If that doesn't work, just ambush them there since they'll be faaar less mobile in the shaft than our drones.

>>36777749
And seriously, even if they get lucky and kill a drone, it just explodes acid all over the shaft.

>>36777719
>Other
Scare the shit of out him, but let him turn on the power. They'll be sitting ducks climbing a ladder in an elevator shaft, that's where we'll ambush them.

>>36777773
>>36777749
Eh, I like this idea.
I still think we she at least injure him a little bit though.
Supporting.

>>36777749
Why not let the guard power it up, kill him, then when Seiner almost reaches the place, sabotage the conduit?
Tempting, I know.

I kinda really want to see what happens if we just kill Seiner before any of his goons.

What would these guards end up doing with themselves?

>>36777784
The conduit is only for opening a door and if the guy doesn't return they'll be suspicious.

>>36777719
The guard moves slowly along the shaft, the sound of Seiner over the radio guides him as he moves.
"It's not far now, pull a left up ahead and head straight down and the conduit will be right in front of you."

A drone crawls behind him, quickly moving across a tunnel and out of sight with nothing but a glisten in the darkness and the sound of scraping claws on metal.

Please roll 1d100, best of 3 to attack.

Rolled 13 (1d100)

>>36777887

Rolled 72 (1d100)

>>36777887

Rolled 66 (1d100)

>>36777887
R I S E

>>36777896
noice

>>36777896
>>36777899

Yea we good.

QD dead?

File: 6649494.png (485 KB, 1024x576)

485 KB PNG

>>36777887
"I think I can see it." The guard says as he moves down a small ladder. He kicks his foot over from the ladder and swings the torch down the path. The sound of groaning metal and scraping claws echoes from elsewhere. "I think those things are getting closer."

Slowly the guard moves to the end of the corridor where the conduit sits, sparks shoot from the exposed wires and bounce off the sleek, dark green coverings of the walls. "Dammit, it looks like something chewed through it. I'm not sure if I can fix it."

"There should be an emergency override, the system has multiple redundancies, you just need to find one." Seiner's voice sounds calmer then he really is. Your fly can hear his heartbeat.

The guard leans over to find the override switch, passing over a number of hanging wires and more sleek coverings. A steamy mist erupts from a set of small tubes along one of the casings in the darkness, and he looks down at it as he rests his lamp on it. The breathing tubes flair again, sending steam in his face. The head of your worker raises up slowly to meet his gaze, and he falls on his back with a shocked scream. With torch in hand he pulls his finger down on the trigger and sends a small pillar of flame down the cramped corridor. The torch is designed to purge contaminated surfaces, and the fire rolls over your worker's carapace and wreaths it in flame as it lunges forward at the guard. His radio drops to the ground, echoing Seiner's voice.

"Anderson? Anderson! Dammit do you read?"

"Oh god!" A lab tech screams as she breaks down into tears while Seiner looks back to his schematic.

After a short period of frantic swiping at the screen he looks back to the group. "There's a maintenance office on the other side of this junction, it should have at least one set of move-assists. If we can get to those we can just force the door open. This way."

"What about Anderson?" The technician is shaking as she struggles to stay coherent. Seiner doesn't respond.

>>36778104
>Ambush the group in the hallway junction
>Attack as they climb the elevator shaft
>Other

>>36778104
>Ambush the group in the hallway junction
>Other
Did we found some kind of self destruct for the lab and if so can we activate it?

>>36778116
>Attack as they climb the elevator

There is no downside to this one.

Also, was Anderson a fan of Alien?

>>36778104
I feel sorry for the technician. Probably worked hard until she was allowed to work on secret project and was just doing her job.

>>36778116
That actually got my heart bumping too, shit's scary.
>Attack as they climb the elevator shaft

They'll have to drop their heavier gear and it'll be more awkward for them to fight while climbing.

>>36778116
Other:
1) Sabotage move-assist(s)
2) Scratch the message "Queen is watching"

Then, when they try to come back, ambush them.

>>36778116
>Attack as they climb the elevator shaft

>>36778127
I feel bad for all of them. They're totally outclassed right now, and it's our workers.

>>36778177
No No

>>36778104
>Attack as they climb the elevator shaft

Please roll 1d100, best of 3.

Rolled 90 (1d100)

>>36778243
Movie Magic

Rolled 2 (1d100)

>>36778243

Rolled 94 (1d100)

>>36778256
Bastard

Rolled 99 (1d100)

>>36778243

May Gieger's phallic fetish be on my side.

>>36778256
Jesus.

>>36778246
>>36778256
>>36778260

>>36778262
All hail Gieger.

>>36778243
We have good karma for staying true to gieger vision

>>36778262
Bless that creepy, phalic obsessed man in the sky.

>>36778260
>>36778262
we clever girl now

File: image_217964_1.jpg (29 KB, 930x523)

29 KB JPG

>>36778104
The door to the office grinds open as Seiner and a guard pull on the sliding doors. The office itself is small and filled with crates and boxes. Spanners and spare parts liter the room.

"Here it is." A guard opens a small box and passes the contents to several others. They attach a number of small servos to each joint, and link them together with a set of folding metal bracers. They freeze as a slow clacking sound echoes from the air vents in the ceiling.

"We need to move now. Take what you can carry." Seiner says. They finish assembling the move-assists and rush out the door. As they approach the door a hiss of breath stops them in their tracks.

One of your workers slowly lowers itself from the ceiling by its blades, its legs unfolding and touching down without a sound on the metal panel floor. A guard grips his pistol, but your fly watches as Seiner places his palm over the weapon as they hide around a corner. He silently shakes his head at the trembling security officer.

your worker stands in silence for nearly a minuet before Seiner takes a small bolt from the ground and tosses it in a nearby hallway. Your drone's head whips to the noise and it rushes down the hall, its blades scraping the ground as it moves.

"Okay, go now." He whispers, and they rush to the sealed doorway. Four guards huddle next to each other and they pull on the doors, their servos whining in protest as the door slowly slides open. The lab tech is the first to fit through the tiny gap, followed by a guard, then Seiner, then the last four guards.

As the last of them attempt to squeeze through a tray of medical instruments is hurled into the hall and your worker marches out. It pivots its head and clicks its mandibles at the group before rushing towards them.

"Suck it in, Stevens, come on!"
The group pulls on the last of the guards, and he slips through as your worker tears the cuff from his sleeve. The doors bend and warp from the force.
cont.

>>36778465
Its easy to forget that our workers are still beastly compared to regular people.

>>36778545
Well, regular people are kind of shit...

>>36778572
Well they are beastly compared to regular people with limited exoskeleton attachments.

>>36778572
We're talking about one of our cheapest and most basic unit.

File: WvMNN5k.jpg (69 KB, 1789x803)

69 KB JPG

>>36778465
A guard pulls his pistol and points it point blank at your drone's head as he pulls the trigger. Seiner jerks his arm up and the bullet slices through the metal grate above them. Your drone rushes reels from the gunshot and leaps into a vent above.

"Are you insane?" He yells. "They have some kind of acid defense mechanism. Shoot it and you'll spray us all with the stuff!"

The guard moves back from the statement and holsters his gun. Seiner gives them all a stern look. "No projectiles. Nothing that breaks the skin." He stands in the elevator in silence for a moment before hopping onto the railing and punching open the foam panel that rests over the escape hatch. They clamber from the elevator one by one and then move to the ladder.

"How far is it?"

"About two hundred meters. Straight up. You want to know how many rungs?"

The machinery of the elevator glistens in the shadows as they continue the climb.

>Attack from above
>Attack from bellow
>Attack from both sides
>Other

>>36778613
>Attack from both sides

>>36778613
>>Attack from above
any acid will be guaranteed to fall either onto them or onto the ladder stranding them

>>36778613
>Attack from both sides
Wait until they're about halfway up, then they can't climb down and our drones just need to make them lose their grip to kill them.

>>36778613
>Attack from below
I wonder what it would take to abduct Seiner alive. We'd just have to make it through the arboretum to the surface, and load him into the Pod we have here before we retrieve it. Since Pods can now enter and leave atmosphere with the new passive upgrade.

>>36778613
>Swarm them.

We now know they have no real way to attack us without killing themselves.

>>36778676
Nah. just kill him.

>>36778676
>I wonder what it would take to abduct Seiner alive
that's WAY more trouble than it's worth, one of the first things we found out researching this guy was a thesis he wrote on capturing, controlling, and enslaving the entire Hive for "Humanity's sake." Fuck. This. Guy.

>>36778692
I just want his juicy chess-club brain. What the hell has he been doing all these years for the Union.

>>36778721
Seiner is just another quest protagonist. Paranoid, prideful, smartest guy in the room, hungry for upgrades and creative uses of whatever he encounters.

>>36778727
We can take his head and sift through it. Brain'll be fine. Nothing's impossible for the Hive!

>>36778613
>Attack from above
Just explode one over them when it gets close, melt the ladder and splash them.

....If we reeeeally wanted to go full H.R Giger with this, we'd take that female techie into the vents and tenderly snuggle her...

>>36778758
I think you mean Seiner.

>>36778613
>> Attack from both sides

Hopefully we're just picking off a couple of them. I'm wondering if we should let the lab tech live or not. We already have Vaughn, but she seems like a non-combatant and generally just has a case of 'wrong place wrong time'.

>>36778741
which is exactly the kind of guy we don't need alive

>>36778745
Extraction from this facility is impossible without alerting the Union to the true nature of the Hive.

>>36778777
No, kill em.

>>36778741

I'm now just imagining the shitstorm going on in Siener Quest.

>Wow, Quest Commander!
>Thanks for putting us in here with the fucking aliens.
>Could have told us they had acid shit!
>And these are the shitty ones!

>>36778777
honestly she'd be the only one I'd consider letting live

>>36778741
Yeah, but one of those quests filled with jerks and That Guys. They deserve to lose their MC.

>>36778773
wanting to snuggle political maneuvering snake and unethical jerk.
ever.

>>36778777
I'm waffling on just letting survivors, uh, survive once Seiner is dead. Buuuut, we don't really want witnesses living to tell the tale. Make us seem way too capable.

>>36778797
I'm pretty sure they don't even /know/ about the warriors.

>>36778809
Eh, Seiner hasn't been much more ruthless than we have. We're just more fabulous.

>>36778786
Power is out. No cameras. Cloaked pod meets them at the surface. Nobody sees nothin.

>>36778777
I'd say abduct them if we could get away with it, but I doubt it. We can make it quick though. possibly have a fly take samples off the corpses to clone, if you guys think we should.

>>36778777
>>36778786
>>36778808
>>36778811

We kill all of them. All of these people are complicit in allowing sapient creatures to die painfully and cruelly all in the name of science. There is no moral quandary, none of them are innocent.

>>36778843
Technicians don't take part in any of that stuff though. They just look after the machinery.

>>36778843
>All of these people are complicit in allowing sapient creatures to die painfully and cruelly all in the name of science.

Who gives a fuck anon? All that matter is if they are useful, not whether they've done "bad" shit.

>>36778843
B-But one of them showed emotions, how can we [possibly kill them now? ...Yeah no people getting squeamish just by being reminded we're killing people is dumb. They're all food now.

>>36778838
In this area of the facility, not the rest of the planet. Maybe not even the surface of this facility. We should kill them and then go over what research is left over and then blow that up as well.
>>36778869
They are not useful to us.
>>36778866
Got to break a few eggs sometimes anon.

>>36778866
>>36778869
They take part in it by allowing it to go on right in front of them. And usefulness doesn't matter, not when we're in the middle of hostile space, because nobody is getting extracted.

>>36778880
>Got to break a few eggs sometimes anon.
funny, that's exactly what Seiner was thinking about us anon

>>36778869
They aren't. Except maybe Seiner, they're useless grunts. He's the only thing of value.

>>36778869
True, but other than Seiner, no one there is useful; And we simply can't trust Seiner.

I suppose we can try to capture him to try and extract data from his brain.

>>36778880
>>36778866 here. I wasn't opposing you, just pointing something out. Not everything's black and white.

>>36778891
Yes, and...?

>>36778891
Doesn't mean he wasn't right. Man why are you getting so antsy now? These aren't the first people we killed
>>36778898
Eh fuck him. Theseus will probably give us anything we could get from his brain for killing him and its less risk to us.

>>36778917
>Theseus will probably give us anything we could get from his brain
Except no, because Theseus has absolutely no idea where Seiner has even been all these years, and he's balls deep in Union clandestine research. It's stuff we could learn as well as sell to Theseus.

>>36778926
But we would have to risk getting him out, which would risk showing that we have god damn space travel.

>>36778926
Not worth it.

>>36778880
Honestly, I was the one who first talked about saving the lab tech, and even I'm not 100% for it. I was just curious.

If she dies, she dies. We've done arguably worse, and we probably would've killed Vaughn if she hadn't absorbed the MacGuffin at the last second.

>>36778946
We killed like four people when we blew up the speaker, one lab tech isn't going to make a difference to us or her bosses. Might as well get rid of all the witnesses.

>>36778946
>We've done arguably worse, and we probably would've killed Vaughn if she hadn't absorbed the MacGuffin at the last second.
That was very unlikely since our aim at the time was to take prisoners not slaughter them.

>>36778946
No, we would have captured her. We would try to capture these humans too if the rest of the planet and the extremely slim chance of actually getting away with it wasn't a factor.
But we gotta do what we gotta do. C'est la vie.

>>36778982
We took those prisoners to experiment on them. They have brain controlling parasites in them now.

>>36778998
Does that somehow change my argument?

>>36778843
We're not glowing bastions of ethical righteousness ourselves, you know. Hell, we kidnapped people and did live experiments on them. We'd have killed them for it too, fi we didn't have the tech to make that unnecessary.

>>36778889
This kind of facility, it's 'let it go on' or be executed themselves.

>>36778898
Can't. We don't have any brainhack drones with us and there's 0% chance of getting his brain out of here.

Overall, I'm not too torn up about killing these people, but trying to justify it by how they're bad people is pointless and hypocritical. Justify it with practicality.

>>36779016
Some would argue that being taken for experimentation and subjecting them to mind control would be a worse thing to do then kill them.

>>36779031
That wasn't what I was arguing against.

>>36779046
Ah I see. I thought you were saying it was unlikely we had done arguably worse.

>>36778613
The group grinds to a halt as the lab tech freezes on the ladder, her eyes locked to the elevator shaft above them.

"Joan, you need to move. What are you waiting for?"

She replies with a hushed, desperate whisper. "We need to go back. Go back!"

The dark shape of your drones unfold their legs and descend from the collection of chains and cables.

"Bellow us! We need to get moving, now!"

The guard in the rear looks down as a group of workers quickly scale the walls of the elevator shaft after them. He pulls out his pistol and fires.

"What the fuck did I say?" Seiner yells.

"Do you see this shit?" The guard screams back, his shaking hand sending several rounds inches above your drones. He holds himself by his elbow as he reloads and continues to fire. One of the shots hits its target and your worker bursts with acid bellow them. Cables simmer and smoke rises from the metal grates.

The cables give, snapping from the pressure and whipping out in a flash. Two more of your drones are sliced in half. The cables whip up and slice through the body of one of the guards, sending his arm flying away as he plummets down the darkened shaft. Another drone is hit above them and a spray of acid rains down from above. Joan quickly sends her lab coat down the elevator shaft as it sizzles, and above the ladder creaks and smokes.

"Jump!"

Joan looks down in a panic "what?" She sees Seiner leap from the creaking ladder to one of the cables. Two of the guards leap and fall, while several manage to make it to the cables. As they tumble out of sight the ladder snaps and falls over, slamming against the other side of the shaft and lodging itself across the girders and supports. Another guard drops into the abyss bellow from the ladder, and the lab tech slips to one hand.

Your workers above drop down, slamming on the ladder and crawling over it with ease. It slips under the weight, and the lab tech's grip slips.
Cont.

>>36778741
Seiner quest when?

File: 1417321183550.jpg (163 KB, 398x499)

163 KB JPG

>>36779149
Oh boy! This is happening!

>>36779149
Poor lab tech lady, she didn't do anything worth dying for.
Can we make sure she lives?

>>36779209
Fuck off. They're all dying.

>>36779209
jesus christ you aren't even being ironic are you. there is zero reason to preserve them.

>>36779209
Yeah. Lets abduct her. You know, for... er... experiments. Yeah experiments.

>>36779209
We just had this conversation. Seems like the answer is 'no, she dies'. I wouldn't care either way, though.

>>36779209
she can live on in your hopes and dreams anon
other than probing her for tech knowledge I'm afraid she's not much use

Lab techs generally know what experiments are going on guys, whos job do you think it is to set them up?

>>36779250
that robotic mop from the lab downstairs, I knew we should have killed it when we had the chance

>>36779260
OH SHIT!! EVERYBODY BACK DOWN NOW!

>>36779209
Other than through cloning, I'm afraid not.

>>36779271
>evil mop just as planned.jpg